𝔖 Bobbio Scriptorium
✦   LIBER   ✦

Sequence of the plastid rDNA spacer region of the brown algaPylaiella littoralis(L.) Kjellm. Evolutionary significance

✍ Scribed by Yves Markowicz; Régis Mache; Susan Loiseaux-De Goër

Publisher
Springer
Year
1988
Tongue
English
Weight
304 KB
Volume
10
Category
Article
ISSN
0167-4412

No coin nor oath required. For personal study only.

✦ Synopsis

The DNA segment situated between the 16S and 23S rRNA genes belonging to the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. has been sequenced. This small region (322 bp) contains two unsplit tRNA genes separated by 3 bp. A comparison with similar regions from different plants shows that this region has evolved in two different ways according to the place of plants in evolution. In the "primitive" group, this region is reduced in size when compared to prokaryotes. In the other groups, it is considerably enlarged by insertion of repetitive sequences, open reading frames and introns.

📜 SIMILAR VOLUMES

Evidence for a composite phylogenetic or
Evidence for a composite phylogenetic origin of the plastid genome of the brown algaPylaiella littoralis(L.) Kjellm
✍ Nour-Eddine Assali; Régis Mache; Susan Loiseaux-de Goër 📂 Article 📅 1990 🏛 Springer 🌐 English ⚖ 637 KB

The nucleotide sequence and the 5' flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase ofPylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and c

Sequence, proposed secondary structure,
Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm
✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG