The DNA segment situated between the 16S and 23S rRNA genes belonging to the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. has been sequenced. This small region (322 bp) contains two unsplit tRNA genes separated by 3 bp. A comparison with similar regions from different plants sh
Physical maps of the two circular plastid DNA molecules of the brown algaPylaiella littoralis(L.) Kjellm
✍ Scribed by Susan Loiseaux-de Goër; Yves Markowicz; Jacques Dalmon; Hélène Audren
- Publisher
- Springer-Verlag
- Year
- 1988
- Tongue
- English
- Weight
- 637 KB
- Volume
- 14
- Category
- Article
- ISSN
- 0172-8083
No coin nor oath required. For personal study only.
📜 SIMILAR VOLUMES
The nucleotide sequence and the 5' flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase ofPylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and c
The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG