𝔖 Bobbio Scriptorium
✦   LIBER   ✦

Evidence for a composite phylogenetic origin of the plastid genome of the brown algaPylaiella littoralis(L.) Kjellm

✍ Scribed by Nour-Eddine Assali; Régis Mache; Susan Loiseaux-de Goër


Publisher
Springer
Year
1990
Tongue
English
Weight
637 KB
Volume
15
Category
Article
ISSN
0167-4412

No coin nor oath required. For personal study only.

✦ Synopsis


The nucleotide sequence and the 5' flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase ofPylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and chemoautotrophic Eubacteria, of a red alga and of green plastids (Euglena gracilis, green algae and higher plants). Unlike the rbcL genes of green plastids which are more closely related to those of cyanobacteria, the P. littoralis rbcL gene is more closely related to that of a B-purple bacterium, as was found for the rbcS gene of another chromophytic alga [Boczar et al., Proc Natl Acad Sci USA 86: 4996-4999, 1989]. Matrix data of homology between the rbcL gene of P. littoralis and the same gene of other organisms are presented. Based on our previous report, the gene coding for the 16S rRNA from P. littoralis is closely related to that ofE. gracilis (Markowicz et al., Curr Genet 14: 599-608, 1988). We suggest that the large plastid DNA molecule of P. littoralis is a phylogenetically composite genome which probably resulted from mixed endosymbiosis events, or from a horizontal transfer of DNA.


📜 SIMILAR VOLUMES


Sequence of the plastid rDNA spacer regi
✍ Yves Markowicz; Régis Mache; Susan Loiseaux-De Goër 📂 Article 📅 1988 🏛 Springer 🌐 English ⚖ 304 KB

The DNA segment situated between the 16S and 23S rRNA genes belonging to the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. has been sequenced. This small region (322 bp) contains two unsplit tRNA genes separated by 3 bp. A comparison with similar regions from different plants sh

Sequence, proposed secondary structure,
✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Plastid genomes of the Rhodophyta and Ch
✍ Yves Markowicz; Susan Loiseaux Goër 📂 Article 📅 1991 🏛 Springer-Verlag 🌐 English ⚖ 368 KB

A phylogenetic tree has been constructed from comparisons of entire 16S rRNA gene sequences from different prokaryotes and from several algal plastids. According to this study, and to previous work on the ribulose-1,5-bisphosphate carboxylase oxygenase (Rubisco) large and small subunit genes, we pos