𝔖 Bobbio Scriptorium
✦   LIBER   ✦

Mutation analysis of the HFE gene associated with hereditary hemochromatosis in a Venezuelan sample

✍ Scribed by Esmeralda Vizzi; Carmen Luisa Loureiro; Marlene Gerder; María de las Nieves Garcia-Casal; Alvaro Rodríguez-Larralde; Letizia Gerace; Juan Ernesto Ludert; Ferdinando Liprandi; Flor Helene Pujol

Publisher
Springer
Year
2005
Tongue
English
Weight
134 KB
Volume
84
Category
Article
ISSN
0939-5555

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Mutation analysis of the HFE gene associ
Mutation analysis of the HFE gene associated with hereditary hemochromatosis in African Americans
✍ Monaghan, Kristin G.; Rybicki, Benjamin A.; Shurafa, Muhammad; Feldman, Gerald L 📂 Article 📅 1998 🏛 John Wiley and Sons 🌐 English ⚖ 155 KB 👁 2 views

Homozygosity for the mutation Cys282Tyr in the HFE gene has recently been identified as a cause of hereditary hemochromatosis, a disorder resulting in the inappropriate absorption of iron. Approximately 10% of Caucasians are heterozygous for this mutation; however, the gene frequency in African Amer

A novel missense mutation S65C in the HF
A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis
✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,

?-thalassemia trait might increase the s
?-thalassemia trait might increase the severity of hemochromatosis in subjects with the C282Y mutation in the HFE gene
✍ Arruda, Valder R.; Agostinho, Marcela F.; Can�ado, Rodolfo; Costa, Fernando F.; 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 170 KB 👁 2 views

## With the C282Y Mutation in the HFE Gene To the Editor: The association between hereditary hemochromatosis and thalassemia syndrome might lead to a severe iron overload [1,2], but the results are still controversial. By PCR and restriction enzyme digestion [3], we analyzed the C282Y and H63D muta