✦ LIBER ✦

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Scribed by Elizabeth Fagan; Stewart J. Payne

Publisher: John Wiley and Sons
Year: 1999
Tongue: English
Weight: 10 KB
Volume: 13
Category: Article
ISSN: 1059-7794
DOI: 10.1002/(sici)1098-1004(1999)13:6<507::aid-humu25>3.0.co;2-x

No coin nor oath required. For personal study only.

✦ Synopsis

Detection conditions

sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis:

SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE, 2W overnight, silver-stain, samples denatured in formamide loading buffer at 94oC, 5 min prior to loading

Diagnosis method developed:

ASO, etc.

SSCP with specific controls. Mutation destroys HinfI site Confirmatory method: Mutation identified by manual sequencing (Sequenase v2.0 kit, Amersham Life Science inc.)

Evidence for existence and effect (mutation) or lack of effect (polymorphism):

📜 SIMILAR VOLUMES

Mutation analysis of the HFE gene associ

Mutation analysis of the HFE gene associated with hereditary hemochromatosis in African Americans

✍ Monaghan, Kristin G.; Rybicki, Benjamin A.; Shurafa, Muhammad; Feldman, Gerald L 📂 Article 📅 1998 🏛 John Wiley and Sons 🌐 English ⚖ 155 KB 👁 2 views

Homozygosity for the mutation Cys282Tyr in the HFE gene has recently been identified as a cause of hereditary hemochromatosis, a disorder resulting in the inappropriate absorption of iron. Approximately 10% of Caucasians are heterozygous for this mutation; however, the gene frequency in African Amer

A novel missense mutation (L198R) in the

A novel missense mutation (L198R) in the Friedreich's ataxia gene

✍ Sahar Al-Mahdawi; Mark Pook; Susan Chamberlain 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 9 KB 👁 1 views

A novel missense mutation 15747 T>C in t

A novel missense mutation 15747 T>C in the mitochondrial cytochrome b gene

✍ Isabel Aguilera; José-raúl García-Lozano; Juan Bautista; Y. Campos; J. Arenas; A 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 11 KB 👁 1 views

A novel missense mutation, S1159F, in ex

A novel missense mutation, S1159F, in exon 19 of the CFTR gene

✍ Hans Hermann Seydewitz; Marcus Mall; Joachim Kuehr 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

A missense mutation W797R in the myophos

A missense mutation W797R in the myophosphorylase gene in a Spanish patient with McArdle's disease

✍ Juan C. Rubio; Miguel A. Martín; Yolanda Campos; Raffaella Auciello; Ana Cabello 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 116 KB 👁 1 views

We identified a novel missense mutation in the myophosphorylase gene (PYGM) in a Spanish patient with McArdle's disease. This homozygous T-to-C transition results in the replacement of a highly conserved tryptophan at amino acid position (aa) 797 with an arginine in the C-terminal domain of the PYGM

W179R: A novel missense mutation in the

W179R: A novel missense mutation in the peripherin/RDS gene in a family with autosomal dominant retinitis pigmentosa

✍ Corinne Bareil; Valérie Delague; Bernard Arnaud; Jacques Demaille; Christian Ham 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 12 KB 👁 1 views