✦ LIBER ✦

A novel missense mutation 15747 T>C in the mitochondrial cytochrome b gene

✍ Scribed by Isabel Aguilera; José-raúl García-Lozano; Juan Bautista; Y. Campos; J. Arenas; Antonio Núñez-Roldán

Publisher: John Wiley and Sons
Year: 1999
Tongue: English
Weight: 11 KB
Volume: 14
Category: Article
ISSN: 1059-7794
DOI: 10.1002/(sici)1098-1004(199912)14:6<545::aid-humu18>3.0.co;2-j

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

A second missense mutation in the mitoch

A second missense mutation in the mitochondrial ATPase 6 gene in Leigh's syndrome

✍ D. Daniëlle de Vries; Baziel G. M. van Engelen; Fons J. M. Gabreëls; Wim Ruitenb 📂 Article 📅 1993 🏛 John Wiley and Sons 🌐 English ⚖ 303 KB 👁 2 views

A novel missense mutation (L198R) in the

A novel missense mutation (L198R) in the Friedreich's ataxia gene

✍ Sahar Al-Mahdawi; Mark Pook; Susan Chamberlain 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 9 KB 👁 1 views

A novel missense mutation, S1159F, in ex

A novel missense mutation, S1159F, in exon 19 of the CFTR gene

✍ Hans Hermann Seydewitz; Marcus Mall; Joachim Kuehr 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

A novel missense mutation S65C in the HF

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,

Transmission of the mitochondrial t8993c

Transmission of the mitochondrial t8993c mutation in a new family

✍ Hurvitz, Haggit ;Naveh, Yaron ;Shoseyov, David ;Klar, Aharon ;Shaag, Avraham ;El 📂 Article 📅 2002 🏛 John Wiley and Sons 🌐 English ⚖ 44 KB

A novel mutation in the mitochondrial tR

A novel mutation in the mitochondrial tRNAVal gene associated with a complex neurological presentation

✍ Valeria Tiranti; Leonardo D'Agruma; Davide Pareyson; Marina Mora; Franco Carrara 📂 Article 📅 1998 🏛 John Wiley and Sons 🌐 English ⚖ 390 KB 👁 1 views