✦ LIBER ✦

Mutation analysis of the HFE gene associated with hereditary hemochromatosis in African Americans

✍ Scribed by Monaghan, Kristin G.; Rybicki, Benjamin A.; Shurafa, Muhammad; Feldman, Gerald L.

Publisher: John Wiley and Sons
Year: 1998
Tongue: English
Weight: 155 KB
Volume: 58
Category: Article
ISSN: 0361-8609
DOI: 10.1002/(sici)1096-8652(199807)58:3<213::aid-ajh9>3.0.co;2-u

No coin nor oath required. For personal study only.

✦ Synopsis

Homozygosity for the mutation Cys282Tyr in the HFE gene has recently been identified as a cause of hereditary hemochromatosis, a disorder resulting in the inappropriate absorption of iron. Approximately 10% of Caucasians are heterozygous for this mutation; however, the gene frequency in African Americans is unknown. A study of a control population of African Americans was performed to determine the frequency of the Cys282Tyr and His63Asp alleles in this ethnic group. The carrier frequency for each mutant allele in our African American population was 3.0%. DNA studies of four African-American hemochromatosis patients did not identify any individuals with the Cys282Tyr allele. These findings suggest that if the Cys282Tyr mutation confers susceptibility to hemochromatosis in Caucasians (as suggested by recent studies) there is an alternative mechanism for hemochromatosis in the American black population. Am.

📜 SIMILAR VOLUMES

?-thalassemia trait might increase the s

?-thalassemia trait might increase the severity of hemochromatosis in subjects with the C282Y mutation in the HFE gene

✍ Arruda, Valder R.; Agostinho, Marcela F.; Can�ado, Rodolfo; Costa, Fernando F.; 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 170 KB 👁 1 views

## With the C282Y Mutation in the HFE Gene To the Editor: The association between hereditary hemochromatosis and thalassemia syndrome might lead to a severe iron overload [1,2], but the results are still controversial. By PCR and restriction enzyme digestion [3], we analyzed the C282Y and H63D muta

A novel missense mutation S65C in the HF

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 1 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,

Estimation of carrier frequency of a 2.7

Estimation of carrier frequency of a 2.7 kb deletion allele of the P gene associated with OCA2 in African-Americans

✍ Donna Durham-Pierre; Richard A. King; John M. Naber; Steve Laken; Murray H. Bril 📂 Article 📅 1996 🏛 John Wiley and Sons 🌐 English ⚖ 303 KB 👁 1 views

Mutation and association analysis of the

Mutation and association analysis of the Fyn kinase gene with alcoholism and schizophrenia

✍ Ishiguro, Hiroki ;Saito, Toshikazu ;Shibuya, Haruo ;Toru, Michio ;Arinami, Tadao 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 84 KB 👁 2 views

Iron overload and prolonged ingestion of

Iron overload and prolonged ingestion of iron supplements: Clinical features and mutation analysis of hemochromatosis-associated genes in four cases

✍ James C. Barton; Pauline L. Lee; Carol West; Sylvia S. Bottomley 📂 Article 📅 2006 🏛 John Wiley and Sons 🌐 English ⚖ 130 KB

Mutation and expression analysis of the

Mutation and expression analysis of the endoglin gene in hereditary hemorrhagic telangiectasia reveals null alleles

✍ Carol J. Gallione; Daniel J. Klaus; Eric Y. Yeh; Timothy T. Stenzel; Yan Xue; Ka 📂 Article 📅 1998 🏛 John Wiley and Sons 🌐 English ⚖ 214 KB 👁 2 views

Hereditary Hemorrhagic Telangiectasia (HHT) is an autosomal dominant disorder characterized by multisystemic vascular dysplasia and recurrent hemorrhage from the sites of vascular lesions. Two genes have been identified for HHT. Endoglin, a TGF-b binding protein which maps to chromosome 9q3, is the