✦ LIBER ✦

HFE gene mutations analysis in Basque hereditary haemochromatosis patients and controls

✍ Scribed by Cuadrado, Emilio; de Juan, MaDolores; Reta, Ana; Castiella, Agustin; Pozueta, Jasone; Prada, Alvaro

Book ID: 110025206
Publisher: Nature Publishing Group
Year: 2001
Tongue: English
Weight: 87 KB
Volume: 9
Category: Article
ISSN: 1018-4813
DOI: 10.1038/sj.ejhg.5200731

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Hereditary haemochromatosis mutations (H

Hereditary haemochromatosis mutations (HFE) in patients with Type II diabetes mellitus

📂 Article 📅 1998 🏛 Springer 🌐 English ⚖ 137 KB

Mutation analysis of the HFE gene in her

Mutation analysis of the HFE gene in hereditary hemochromatosis

✍ O. Kenneth; C.A. Buettner; J. Genschel; M. Steiner; H. Gerl; Werner P. Schuff; H 📂 Article 📅 2001 🏛 Elsevier Science 🌐 English ⚖ 137 KB

Prevalence of the Cys282Tyr and His63Asp

Prevalence of the Cys282Tyr and His63Asp HFE gene mutations in Spanish patients with hereditary hemochromatosis and in controls

✍ Mayka Sánchez; Miquel Bruguera; Jaume Bosch; Joan Rodés; Francisca Ballesta; Raf 📂 Article 📅 1998 🏛 Elsevier Science 🌐 English ⚖ 76 KB

C282Y mutation in HFE (haemochromatosis)

C282Y mutation in HFE (haemochromatosis) gene and type 2 diabetes

✍ Tim Frayling; Sian Ellard; Jane Grove; Mark Walker; Andrew T Hattersley 📂 Article 📅 1998 🏛 The Lancet 🌐 English ⚖ 84 KB

A novel missense mutation S65C in the HF

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,

Prevalence of C282Y and H63D mutations i

Prevalence of C282Y and H63D mutations in the haemochromatosis (HFE) gene in Tunisian population

✍ R. Sassi; Slama Hmida; H. Kaabi; A. Hajjej; A. Abid; S. Abdelkefi; S. Yacoub; M. 📂 Article 📅 2004 🏛 Elsevier Science 🌐 English ⚖ 93 KB