✦ LIBER ✦

Two novel polymorphisms (E277K and V212V) in the haemochromatosis gene HFE

✍ Scribed by Rachel Bradbury; Elizabeth Fagan; Stewart J. Payne

Book ID: 101262191
Publisher: John Wiley and Sons
Year: 2000
Tongue: English
Weight: 14 KB
Volume: 15
Category: Article
ISSN: 1059-7794
DOI: 10.1002/(sici)1098-1004(200001)15:1<120::aid-humu32>3.0.co;2-b

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

C282Y mutation in HFE (haemochromatosis)

C282Y mutation in HFE (haemochromatosis) gene and type 2 diabetes

✍ Tim Frayling; Sian Ellard; Jane Grove; Mark Walker; Andrew T Hattersley 📂 Article 📅 1998 🏛 The Lancet 🌐 English ⚖ 84 KB

A novel missense mutation S65C in the HF

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,

Prevalence of C282Y and H63D mutations i

Prevalence of C282Y and H63D mutations in the haemochromatosis (HFE) gene in Tunisian population

✍ R. Sassi; Slama Hmida; H. Kaabi; A. Hajjej; A. Abid; S. Abdelkefi; S. Yacoub; M. 📂 Article 📅 2004 🏛 Elsevier Science 🌐 English ⚖ 93 KB

Two novel biallelic polymorphisms in the

Two novel biallelic polymorphisms in the IL‐2 gene

✍ John, S. ;Turner, D. ;Donn, R. ;Sinnott, P. ;Worthington, J. ;Ollier, W. E. R. ; 📂 Article 📅 1998 🏛 John Wiley and Sons 🌐 English ⚖ 83 KB

Iron metabolism and the role of HFE gene

Iron metabolism and the role of HFE gene polymorphisms in Wilson disease

✍ Jan Pfeiffenberger; Daniel N. Gotthardt; Thomas Herrmann; Jessica Seeßle; Uta Me 📂 Article 📅 2011 🏛 John Wiley and Sons 🌐 English ⚖ 161 KB

Frequencies of the haemochromatosis gene

Frequencies of the haemochromatosis gene (HFE) variants C282Y, H63D and S65C in 6,020 ethnic Danish men

✍ Palle Pedersen; Gitte Vedel Melsen; Nils Milman 📂 Article 📅 2008 🏛 Springer 🌐 English ⚖ 134 KB