✦ LIBER ✦

The construction of ISIS 1, A 4 m×2 m× 1.6 m drift chamber for particle identification

✍ Scribed by W.W.M. Allison; C.B. Brooks; A.R. Holmes

Publisher: Elsevier Science
Year: 1978
Weight: 279 KB
Volume: 156
Category: Article
ISSN: 0029-554X
DOI: 10.1016/0029-554x(78)90709-7

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

ChemInform Abstract: The Structure of th

ChemInform Abstract: The Structure of the Lithium-Rich Garnets Li6SrLa2M2O12 and Li6.4Sr1.4La1.6M2O12 (M: Sb, Ta).

✍ Michael P. O'Callaghan; Edmund J. Cussen 📂 Article 📅 2008 🏛 John Wiley and Sons ⚖ 17 KB 👁 1 views

Comparative studies on the thermal decom

Comparative studies on the thermal decomposition of M[M(C2O4)2] · xH2O (x = 4 for M = Mn(II), Co(II), Zn(II); x = 5 for M = Ni(II); x = 6 for M = Cd(II) and x = 1 for M = Sn(II))

✍ N. Deb; N.N. Dass; P.K. Gogoi 📂 Article 📅 1992 🏛 Elsevier Science 🌐 English ⚖ 530 KB

The mechanical basis of respiration. By

The mechanical basis of respiration. By Richard M. Peters, M.D., California. 9 × 6 1/2 in. Pp. 393 — xii. Illustrated. 1969. London: J. × A. Churchill Ltd. £7 10s

📂 Article 📅 1970 🏛 John Wiley and Sons 🌐 English ⚖ 136 KB 👁 1 views

The m2 and m4 polymorphisms in CYP1A1 by

The m2 and m4 polymorphisms in CYP1A1 by NcoI digest—Revision of detection method

✍ David Israeli; Yael Patael; Tal Friedman; Eitan Friedman 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 16 KB

## Detection conditions: C1: GAAAGGCTGGGTCCACCCTCT C2: CCAGGAAGAGAAAGACCTCCCAGCGGGCCA Final reaction volume was 50 µl and the reaction contained 100 nanogr of DNA, 30 picomoles of each primers, 10X standard PCR buffer, 200 mM of dNTP's and 0.3 units of thermostable DNA polymerase. Thremal cycling p

A 1 m2 gamma ray spark chamber telescope

A 1 m2 gamma ray spark chamber telescope for the energy range 10–100 MeV

✍ B. Parlier; B. Agrinier; E. Bonfand; B. Mougin; A. Lecomte; J. Andrejol; J.C. Co 📂 Article 📅 1978 🏛 Elsevier Science ⚖ 589 KB

Development of a 150 m2 proportional cha

Development of a 150 m2 proportional chamber system with a 1 million bit buffer: The EMI for BEBC

✍ C. Brand; R.C.A. Brown; E. Chesi; H. Foeth; A. Gilgrass; H.J. Hilke; D. Jacobs; 📂 Article 📅 1976 🏛 Elsevier Science ⚖ 947 KB