𝔖 Bobbio Scriptorium
✦   LIBER   ✦

The m2 and m4 polymorphisms in CYP1A1 by NcoI digest—Revision of detection method

✍ Scribed by David Israeli; Yael Patael; Tal Friedman; Eitan Friedman

Publisher
John Wiley and Sons
Year
2000
Tongue
English
Weight
16 KB
Volume
15
Category
Article
ISSN
1059-7794

No coin nor oath required. For personal study only.

✦ Synopsis

Detection conditions:

C1: GAAAGGCTGGGTCCACCCTCT C2: CCAGGAAGAGAAAGACCTCCCAGCGGGCCA Final reaction volume was 50 µl and the reaction contained 100 nanogr of DNA, 30 picomoles of each primers, 10X standard PCR buffer, 200 mM of dNTP's and 0.3 units of thermostable DNA polymerase. Thremal cycling profile consisted of an initial denaturing step of 94C for 5 minutes, followed by 30 cycles of denaturation at 94c for 45s, annealing at 66C for 1 minute and extension at 72C for 1 minute, followed by a final extension step of 5 minutes at 72C.

Diagnosis method developed:

📜 SIMILAR VOLUMES

ChemInform Abstract: Mixed Cations and S
ChemInform Abstract: Mixed Cations and Structural Complexity in (Eu1-xCax)4In3Ge4 and (Eu1-xCax)3In2Ge3 — The First Two Members of the Homologous Series A2[n+m]In2n+mGe2[n+m] (n, m = 1, 2,···∞; A: Ca, Sr, Ba, Eu, or Yb).
✍ Tae-Soo You; Paul H. Tobash; Svilen Bobev 📂 Article 📅 2010 🏛 John Wiley and Sons ⚖ 21 KB 👁 1 views

## Abstract ChemInform is a weekly Abstracting Service, delivering concise information at a glance that was extracted from about 100 leading journals. To access a ChemInform Abstract of an article which was published elsewhere, please select a “Full Text” option. The original article is trackable v

Structural Studies and Order–Disorder Ph
Structural Studies and Order–Disorder Phenomenon in a Series of New Quaternary Tellurates of the Type A2+M4+Te6+O6 and A1+2M4+Te6+O6
✍ Patrick M. Woodward; Arthur W. Sleight; Lin-Shu Du; Clare P. Grey 📂 Article 📅 1999 🏛 Elsevier Science 🌐 English ⚖ 511 KB

and two forms of Na 2 GeTeO 6 . All compounds are layered structures based on various stacking arrangements of MTeO 2؊ 6 layers. The structures of BaGeTeO 6 and SrGeTeO 6 were also determined. The former compound was found to contain Ba 2؉ in trigonal prismatic coordination, in agreement with previo