✦ LIBER ✦

TEACHING BY TAPE 1, 2A Method of Undergraduate Instruction in Child Psychiatry

✍ Scribed by PINKERTON, P

Book ID: 122443876
Publisher: The Lancet
Year: 1961
Tongue: English
Weight: 322 KB
Volume: 278
Category: Article
ISSN: 0140-6736
DOI: 10.1016/S0140-6736(61)90595-5

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

A Comparison of Results Obtained by Two

A Comparison of Results Obtained by Two Methods of Instruction Employed in Teaching Pharmaceutical Chemistry**Section on Education and Legislation, A. PH. A., Madison meeting, 1933.

✍ Rodgers, Charles H. 📂 Article 📅 1934 🏛 Elsevier ⚖ 245 KB

Quantification of CYP1A1 and 2B1/2 in ra

Quantification of CYP1A1 and 2B1/2 in rat hepatocytes cultured in microwells by immunological methods

✍ Herrero, M.E.; Castell, J.V. 📂 Article 📅 1994 🏛 Elsevier Science 🌐 English ⚖ 824 KB

The m2 and m4 polymorphisms in CYP1A1 by

The m2 and m4 polymorphisms in CYP1A1 by NcoI digest—Revision of detection method

✍ David Israeli; Yael Patael; Tal Friedman; Eitan Friedman 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 16 KB

## Detection conditions: C1: GAAAGGCTGGGTCCACCCTCT C2: CCAGGAAGAGAAAGACCTCCCAGCGGGCCA Final reaction volume was 50 µl and the reaction contained 100 nanogr of DNA, 30 picomoles of each primers, 10X standard PCR buffer, 200 mM of dNTP's and 0.3 units of thermostable DNA polymerase. Thremal cycling p

Deformation Effects on the Structure and

Deformation Effects on the Structure and Properties of Y1−xCaxBa2Cu3O7−δ(x=0;0.3) Tapes Produced by OPIT Method in the Ag-Tube

✍ H. Ignatov; E. Nazarova; A. Zahariev; V. Lazarova; J. Georgiev; A. Stoyanova-Iva 📂 Article 📅 2007 🏛 Springer 🌐 English ⚖ 273 KB

Determination of the Position of the Con

Determination of the Position of the Conformational Equilibrium of a Trans 1,2-Disubstituted Cyclohexane by NMR Spectroscopy. An Experiment in Physical Organic Chemistry for Undergraduate Students

✍ Kutateladze, Andrei G.; Hornback, Joseph M. 📂 Article 📅 2001 🏛 American Chemical Society 🌐 English ⚖ 75 KB

Synthesis of LiNi1/3Co1/3Mn1/3O2 cathode

Synthesis of LiNi1/3Co1/3Mn1/3O2 cathode materials by using a supercritical water method in a batch reactor

✍ Jae-Wook Lee; Jae-Hyuk Lee; Tran Tan Viet; Jin-Young Lee; Joon-Soo Kim; Chang-Ha 📂 Article 📅 2010 🏛 Elsevier Science 🌐 English ⚖ 781 KB

TEACHING BY TAPE *1, *2A Method of Undergraduate Instruction in Child Psychiatry

TEACHING BY TAPE 1, 2A Method of Undergraduate Instruction in Child Psychiatry