✦ LIBER ✦

Sequence and phylogenetic analyses of the chloroplast 16S rRNA,tufA, andrbcL genes fromBryopsis hypnoides

✍ Scribed by Fang Lü; Guangce Wang

Publisher: Springer
Year: 2011
Tongue: English
Weight: 314 KB
Volume: 29
Category: Article
ISSN: 0254-4059
DOI: 10.1007/s00343-011-0084-9

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Sequence, proposed secondary structure,

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm

✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Identification of Acetobacter strains fr

Identification of Acetobacter strains from Thai fermented rice products based on the 16S rRNA gene sequence and 16S–23S rRNA gene internal transcribed spacer restriction analyses

✍ Somboon Tanasupawat; Jintana Kommanee; Pattaraporn Yukphan; Yasuyoshi Nakagawa; 📂 Article 📅 2011 🏛 John Wiley and Sons 🌐 English ⚖ 264 KB

Phylogenetic position of an obligately c

Phylogenetic position of an obligately chemoautotrophic, marine hydrogen-oxidizing bacterium, Hydrogenovibrio marinus, on the basis of 16S rRNA gene sequences and two form I RuBisCO gene sequences

✍ H. Nishihara; Toshiaki Yaguchi; Seon Yong Chung; Ken-ichiro Suzuki; M. Yanagi; K 📂 Article 📅 1998 🏛 Springer 🌐 English ⚖ 127 KB