✦ LIBER ✦

Putative DNA G-quadruplex formation within the promoters ofPlasmodium falciparum vargenes

✍ Scribed by Nicolas Smargiasso; Valérie Gabelica; Christian Damblon; Frédéric Rosu; Edwin De Pauw; Marie-Paule Teulade-Fichou; J Alexandra Rowe; Antoine Claessens

Book ID: 115002999
Publisher: BioMed Central
Year: 2009
Tongue: English
Weight: 906 KB
Volume: 10
Category: Article
ISSN: 1471-2164
DOI: 10.1186/1471-2164-10-362

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Putative DNA Quadruplex Formation within

Putative DNA Quadruplex Formation within the Human c-kit Oncogene

✍ Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary 📂 Article 📅 2005 🏛 American Chemical Society 🌐 English ⚖ 134 KB

Putative DNA Quadruplex Formation within

Putative DNA Quadruplex Formation within the Human c-kit Oncogene

✍ Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary 📂 Article 📅 2005 🏛 American Chemical Society 🌐 English ⚖ 134 KB

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Vari