✦ LIBER ✦

Nucleotide sequence ofCitrus limon26S rRNA gene and secondary structure model of its RNA

✍ Scribed by Vladimir O. Kolosha; Istvan Fodor

Publisher: Springer
Year: 1990
Tongue: English
Weight: 962 KB
Volume: 14
Category: Article
ISSN: 0167-4412
DOI: 10.1007/bf00018556

No coin nor oath required. For personal study only.

✦ Synopsis

The complete nucleotide sequence of Citrus limon 26S rDNA has been determined. The sequence has been aligned with large ribosomal RNA (L-rRNA) sequences ofEscherichia coli, Saccharomyces cerevisiae and Oryza sativa. Nine extensive expansion segments in dicot 26S rRNA relative to E. coli 23S rRNA have been identified and compared with analogous segments of monocot, yeast, amphibian and human L-rRNAs. A secondary structure model for lemon 26S rRNA has been derived based on the refined model of E. coli 23 S rRNA. It has been compared with other eukaryotic L-rRNAs models in terms of location of functionally important regions. Origin and evolution of L-rRNA expansion segments are discussed.

📜 SIMILAR VOLUMES

Cloning and sequence analysis of the 18

Cloning and sequence analysis of the 18 S ribosomal RNA gene of tomato and a secondary structure model for the 18 S rRNA of angiosperms

✍ Schmidt-Puchta, Waltraud ;Kütemeier, Gertrud ;Günther, Isolde ;Haas, Bernd ;Säng 📂 Article 📅 1989 🏛 Springer 🌐 English ⚖ 876 KB

Partial nucleotide sequence of a single

Partial nucleotide sequence of a single ribosomal RNA coding region and secondary structure of the large subunit 25 s rRNA ofCandida albicans

✍ Thyagarajan Srikantha; Robin R. Gutell; Brian Morrow; David R. Soll 📂 Article 📅 1994 🏛 Springer-Verlag 🌐 English ⚖ 787 KB

Nucleotide sequence of theSchizosaccharo

Nucleotide sequence of theSchizosaccharomyces japonicusvar.versatilisribosomal RNA gene cluster and its phylogenetic implications

✍ Joerg Naehring; Stefan Kiefer; Klaus Wolf 📂 Article 📅 1995 🏛 Springer-Verlag 🌐 English ⚖ 783 KB

Fission yeasts form a small but heterogeneous group of ascomycetes and it is still unclear whether they should be subdivided into three genera (Schizosaccharomyces, Octosporomyces, Hasegawaea) or remain a single genus (Schizosaccharomyces). In order to decide whether a new genus Hasegawaea should be

Nucleotide sequence and presumed seconda

Nucleotide sequence and presumed secondary structure of the 28S rRNA of pea aphid implication for diversification of insect rRNA

✍ Daisuke Amako; O-Yu Kwon; Hajime Ishikawa 📂 Article 📅 1996 🏛 Springer 🌐 English ⚖ 663 KB

Sequence, proposed secondary structure,

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm

✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Primary and secondary structure of the n

Primary and secondary structure of the nuclear small subunit ribosomal RNA of the cryptomonadPyrenomonas salinaas inferred from the gene sequence: Evolutionary implications

✍ Stefan Eschbach; Jörn Wolters; Peter Sitte 📂 Article 📅 1991 🏛 Springer 🌐 English ⚖ 506 KB