✦ LIBER ✦

Cloning and sequence analysis of the 18 S ribosomal RNA gene of tomato and a secondary structure model for the 18 S rRNA of angiosperms

✍ Scribed by Schmidt-Puchta, Waltraud ;Kütemeier, Gertrud ;Günther, Isolde ;Haas, Bernd ;Sänger, Heinz L.

Publisher: Springer
Year: 1989
Tongue: English
Weight: 876 KB
Volume: 219
Category: Article
ISSN: 0026-8925
DOI: 10.1007/bf00261152

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

The 18S and 5S ribosomal RNA genes in Oe

The 18S and 5S ribosomal RNA genes in Oenothera mitochondria: Sequence rearrangments in the 18S and 5S rRNA genes of higher plants

✍ Brennicke, Axel ;Möller, Sabine ;Blanz, Paul A. 📂 Article 📅 1985 🏛 Springer 🌐 English ⚖ 637 KB

Partial nucleotide sequence of a single

Partial nucleotide sequence of a single ribosomal RNA coding region and secondary structure of the large subunit 25 s rRNA ofCandida albicans

✍ Thyagarajan Srikantha; Robin R. Gutell; Brian Morrow; David R. Soll 📂 Article 📅 1994 🏛 Springer-Verlag 🌐 English ⚖ 787 KB

Cloning and Characterization of theKlDIM

Cloning and Characterization of theKlDIM1 Gene fromKluyveromyces lactis Encoding the m26A Dimethylase of the 18S rRNA

✍ HOUSEN, ISABELLE; DEMONTÉ, DOMINIQUE; LAFONTAINE, DENIS; VANDENHAUTE, JEAN 📂 Article 📅 1997 🏛 John Wiley and Sons 🌐 English ⚖ 154 KB 👁 2 views

The KlDIM1 gene encoding the m 2 6 A rRNA dimethylase was cloned from a Kluyveromyces lactis genomic library using a PCR amplicon from the Saccharomyces cerevisiae ScDIM1 gene as probe. The KlDIM1 gene encodes a 320-amino acid protein which shows 81% identity to ScDim1p from S. cerevisiae and 25% id

Sequence, proposed secondary structure,

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm

✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Cloning and nucleotide sequencing of the

Cloning and nucleotide sequencing of the genes rimI and rimJ which encode enzymes acetylating ribosomal proteins S18 and S5 of Escherichia coli K12

✍ Yoshikawa, Akikazu ;Isono, Setsuko ;Sheback, Abraham ;Isono, Katsumi 📂 Article 📅 1987 🏛 Springer 🌐 English ⚖ 821 KB

The nucleotide sequence of an Escherichi

The nucleotide sequence of an Escherichia coli chromosomal region containing the genes for ribosomal proteins S6, S18, L9 and an open reading frame

✍ Schnier, Joachim ;Kitakawa, Madoka ;Isono, Katsumi 📂 Article 📅 1986 🏛 Springer 🌐 English ⚖ 684 KB