✦ LIBER ✦

Nuclease S1analysis of eubacterial 5S rRNA secondary structure

✍ Scribed by M. T. MacDonell; R. R. Colwell

Publisher: Springer
Year: 1985
Tongue: English
Weight: 494 KB
Volume: 22
Category: Article
ISSN: 0022-2844
DOI: 10.1007/bf02099753

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

A unique type of eubacterial 5S rRNA in

A unique type of eubacterial 5S rRNA in members of the order Planctomycetales

✍ Daniel Bomar; Stephen Giovannoni; Erko Stackebrandt 📂 Article 📅 1988 🏛 Springer 🌐 English ⚖ 412 KB

AnE. coli5S rRNA Deletion Mutant Useful

AnE. coli5S rRNA Deletion Mutant Useful for the Study of 5S rRNA Structure/Function Relationships

✍ David Ammons; Joanne Rampersad 📂 Article 📅 2001 🏛 Springer 🌐 English ⚖ 37 KB

18S rRNA Secondary Structure and Phyloge

18S rRNA Secondary Structure and Phylogenetic Position of Peloridiidae (Insecta, Hemiptera)

✍ David Ouvrard; Bruce C. Campbell; Thierry Bourgoin; Kathleen L. Chan 📂 Article 📅 2000 🏛 Elsevier Science 🌐 English ⚖ 244 KB

A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory sub

Molecular organization of dinoflagellate

Molecular organization of dinoflagellate ribosomal DNA: evolutionary implications of the deduced 5.8 S rRNA secondary structure

✍ Luc Maroteaux; Michel Herzog; Marie-Odile Soyer-Gobillard 📂 Article 📅 1985 🏛 Elsevier Science 🌐 English ⚖ 912 KB

Sequence, proposed secondary structure,

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm

✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Analysis of 3′ and 5′ Ends of RNA by Sol

Analysis of 3′ and 5′ Ends of RNA by Solid-Phase S1 Nuclease Mapping

✍ Andrzej Dziembowski; Piotr P. Stepien 📂 Article 📅 2001 🏛 Elsevier Science 🌐 English ⚖ 64 KB

Use of a novel rapid preparation of fat-cells plasma membranes employing Percoll to investigate the effects of insulin and adrenaline on membrane protein phosphorylation with in intact fat cells. Biochem.