𝔖 Bobbio Scriptorium
✦   LIBER   ✦

18S rRNA Secondary Structure and Phylogenetic Position of Peloridiidae (Insecta, Hemiptera)

✍ Scribed by David Ouvrard; Bruce C. Campbell; Thierry Bourgoin; Kathleen L. Chan


Publisher
Elsevier Science
Year
2000
Tongue
English
Weight
244 KB
Volume
16
Category
Article
ISSN
1055-7903

No coin nor oath required. For personal study only.

✦ Synopsis


A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current freeenergy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed.


πŸ“œ SIMILAR VOLUMES


Sequence, proposed secondary structure,
✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de GoΓ«r πŸ“‚ Article πŸ“… 1992 πŸ› Springer 🌐 English βš– 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Phylogenetic Relationships Inferred from
✍ Menno Schilthuizen; Edmund Gittenberger; Alexander P. Gultyaev πŸ“‚ Article πŸ“… 1995 πŸ› Elsevier Science 🌐 English βš– 521 KB

An analysis of the ITS1 sequence variation among five species of terrestrial pulmonate snails was performed to decide between two conflicting hypotheses concerning the phylogeny of these anatomically similar gastropods. It turned out that the so-called genus Isabellaria is a polyphyletic entity; the