✦ LIBER ✦

Novel missense mutation in ALS2 gene results in infantile ascending hereditary spastic paralysis

✍ Scribed by Eleonore Eymard-Pierre; Koji Yamanaka; Martin Haeussler; Wolfram Kress; Fernande Gauthier-Barichard; Patricia Combes; Don W. Cleveland; Odile Boespflug-Tanguy

Publisher: John Wiley and Sons
Year: 2006
Tongue: English
Weight: 182 KB
Volume: 59
Category: Article
ISSN: 0364-5134
DOI: 10.1002/ana.20879

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

An ALS2 gene mutation causes hereditary

An ALS2 gene mutation causes hereditary spastic paraplegia in a Pakistani kindred

✍ François Gros-Louis; Inge A. Meijer; Collette K. Hand; Marie-Pierre Dubé; Daune 📂 Article 📅 2002 🏛 John Wiley and Sons 🌐 English ⚖ 94 KB 👁 1 views

A novel missense mutation S65C in the HF

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,

A novel missense mutation in the NDP gen

A novel missense mutation in the NDP gene in a child with Norrie disease and severe neurological involvement including infantile spasms

✍ Dorit Lev; Yuval Weigl; Mariana Hasan; Eva Gak; Michael Davidovich; Chana Vinkle 📂 Article 📅 2007 🏛 John Wiley and Sons 🌐 English ⚖ 207 KB 👁 2 views