✦ LIBER ✦

Cloning and analysis of recombinant plasmids containing genes forAspergillus nidulans5 S rRNA

✍ Scribed by Ewa Bartnik; Katarzyna Strugala; Piotr P. Stepien

Publisher: Springer-Verlag
Year: 1981
Tongue: English
Weight: 301 KB
Volume: 4
Category: Article
ISSN: 0172-8083
DOI: 10.1007/bf00420494

No coin nor oath required. For personal study only.

✦ Synopsis

Genes coding for 5S rRNA were found to be dispersed in the Aspergillus nidulans genome. Three different recombinant plasmids hybridizing to 5S rRNA were isolated and their restriction enzyme maps were established.

📜 SIMILAR VOLUMES

Expression and immunogenicity in rats of

Expression and immunogenicity in rats of recombinant adenovirus 5 DNA plasmids and vaccinia virus containing the HTLV-I-env gene

✍ Mirdad Kazanji; Robert Bomford; Jean-Louis Bessereau; Thomas Schulz; Guy de Thé 📂 Article 📅 1997 🏛 John Wiley and Sons 🌐 French ⚖ 188 KB 👁 2 views

The complete human T-cell leukemia virus type I (HTLV-I) env gene was inserted into an expression cassette containing the adenovirus 5 major late promoter (Ad5-MLP). Recombinant Ad5-HTLV-I-env was obtained by homologous recombination in 293 cells simultaneously transfected by the expression cassette

Cloning and sequence analysis of the 18

Cloning and sequence analysis of the 18 S ribosomal RNA gene of tomato and a secondary structure model for the 18 S rRNA of angiosperms

✍ Schmidt-Puchta, Waltraud ;Kütemeier, Gertrud ;Günther, Isolde ;Haas, Bernd ;Säng 📂 Article 📅 1989 🏛 Springer 🌐 English ⚖ 876 KB

The 5′-upstream region of the yeast 25S

The 5′-upstream region of the yeast 25S rRNA gene contains a promoter element allowing expression in yeast andE. coli

✍ Gertrud Strobel; Viktor Magdolen; Ulrich Oechsner; Ho-Sa Huh; Wolfhard Bandlow 📂 Article 📅 1988 🏛 Springer-Verlag 🌐 English ⚖ 933 KB

The 25S rRNA gene of Saccharomyces cerevisiae is preceded by a bona fide TATA sequence which allows the initiation of transcription--presumably by polymerase II--from the same strand as the 25S rRNA gene. When the promoter fragment is cloned in front of a lacZ gene equipped with an initiation codon

Sequence, proposed secondary structure,

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm

✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG