✦ LIBER ✦

Analysis of the Primary Sequence and Secondary Structure of the Unusually Long SSU rRNA of the Soil Bug,Armadillidium vulgare

✍ Scribed by Pyo Choe, Chong; Hancock, John M.; Wook Hwang, Ui; Kim, Won

Book ID: 113012007
Publisher: Springer
Year: 1999
Tongue: English
Weight: 592 KB
Volume: 49
Category: Article
ISSN: 0022-2844
DOI: 10.1007/pl00006602

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Evolution of mitochondrial SSU-rDNA vari

Evolution of mitochondrial SSU-rDNA variable domain sequences and rRNA secondary structures, and phylogeny of the Agrocybe aegerita multispecies complex

✍ Marina Uhart; Pascal Sirand-Pugnet; Jacques Labarère 📂 Article 📅 2007 🏛 Elsevier Science 🌐 English ⚖ 471 KB

The Unusually Long Small-Subunit Ribosom

The Unusually Long Small-Subunit Ribosomal RNA of the Crustacean,Daphnia pulex:Sequence and Predicted Secondary Structure

✍ Crease, Teresa J.; Colbourne, John K. 📂 Article 📅 1998 🏛 Springer 🌐 English ⚖ 740 KB

Models of the Primary and Secondary Stru

Models of the Primary and Secondary Structure for the 12S rRNA of Birds: A Guideline for Sequence Alignment

✍ de los Monteros, Alejandro Espinosa 📂 Article 📅 2003 🏛 Informa plc 🌐 English ⚖ 657 KB

Sequence, proposed secondary structure,

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown algaPylaiella littoralis(L.) Kjellm

✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

A CAPS test allowing a rapid distinction

A CAPS test allowing a rapid distinction of Penicillium expansum among fungal species collected on grape berries, inferred from the sequence and secondary structure of the mitochondrial SSU-rRNA

✍ Carole Garcia; Stéphane La Guerche; Bello Mouhamadou; Cyril Férandon; Jacques La 📂 Article 📅 2006 🏛 Elsevier Science 🌐 English ⚖ 603 KB

Cloning and sequence analysis of the 18

Cloning and sequence analysis of the 18 S ribosomal RNA gene of tomato and a secondary structure model for the 18 S rRNA of angiosperms

✍ Schmidt-Puchta, Waltraud ;Kütemeier, Gertrud ;Günther, Isolde ;Haas, Bernd ;Säng 📂 Article 📅 1989 🏛 Springer 🌐 English ⚖ 876 KB