✦ LIBER ✦

A missense mutation in the OCTN2 gene associated with residual carnitine transport activity

✍ Scribed by Yuhuan Wang; Michelle A. Kelly; Tina M. Cowan; Nicola Longo

Publisher: John Wiley and Sons
Year: 2000
Tongue: English
Weight: 302 KB
Volume: 15
Category: Article
ISSN: 1059-7794
DOI: 10.1002/(sici)1098-1004(200003)15:3<238::aid-humu4>3.0.co;2-3

No coin nor oath required. For personal study only.

✦ Synopsis

Primary carnitine deficiency is an autosomal recessive disorder of fatty acid oxidation caused by defective carnitine transport. This disease can present early in life with hypoketotic hypoglycemia and acute metabolic decompensation, or later in life with skeletal or cardiac myopathy. Mutations abolishing the function of OCTN2, an organic cation/carnitine transporter with twelve putative transmembrane spanning domains, were recently demonstrated in patients with early-and lateonset (up to seven years of age) presentation of this syndrome. Most of the reported mutations are null alleles. Here we evaluate the OCTN2 gene in a male patient who presented at seven years of age with severe dilated cardiomyopathy. Plasma carnitine levels were undetectable and carnitine transport by his fibroblasts was reduced to about 3% of normal controls. This patient was homozygous for a single base pair change in exon 8 of the OCTN2 gene (1354G>A) converting the codon for Glu 452 to Lys (E452K) in the predicted intracellular loop between transmembrane domains 10 and 11. Stable expression of the mutant E452K-OCTN2 cDNA in Chinese hamster ovary (CHO) cells caused a partial increase in carnitine transport to 2-4% of the levels measured in the wild type transporter. This reduced transport activity was associated with normal Km toward carnitine (3.1 ± 1.1 mM), but markedly reduced Vmax. These results indicate that primary carnitine deficiency can be caused by mutations encoding for carnitine transporters with residual activity, and that the E452K affects a domain not involved in carnitine recognition.

📜 SIMILAR VOLUMES

Two novel missense mutations of the OCTN

Two novel missense mutations of the OCTN2 gene (W283R and V446F) in a patient with primary systemic carnitine deficiency

✍ E. Mayatepek; J. Nezu; I. Tamai; A. Oku; M. Katsura; M. Shimane; A. Tsuji 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 20 KB 👁 1 views

Primary systemic carnitine deficiency (SCD) is an autosomal recessive disorder of fatty acid oxidation caused by defective cellular carnitine transport. The disease is characterized by metabolic derangement simulating Reye´s syndrome, hypoglcaemia, progressive cardiomyopathy and skeletal myopathy. R

A missense mutation in the ZFHX1B gene a

A missense mutation in the ZFHX1B gene associated with an atypical Mowat–Wilson syndrome phenotype

✍ Wolfram Heinritz; Christiane Zweier; Ursula G. Froster; Sibylle Strenge; Annegre 📂 Article 📅 2006 🏛 John Wiley and Sons 🌐 English ⚖ 214 KB 👁 2 views

A missense (T577I) mutation in the lutei

A missense (T577I) mutation in the luteinizing hormone receptor gene associated with familial male-limited precocious puberty

✍ Sandro Cocco; Antonella Meloni; Maria Giuseppina Marini; Antonio Cao; Paolo Moi 📂 Article 📅 1996 🏛 John Wiley and Sons 🌐 English ⚖ 229 KB 👁 2 views

## Communicated trj F a d Chehab Familial male-limited precocious puberty (FMPP) is an autosomal dominant condition that affects exclusively boys. The isosexual precocious

A missense mutation W797R in the myophos

A missense mutation W797R in the myophosphorylase gene in a Spanish patient with McArdle's disease

✍ Juan C. Rubio; Miguel A. Martín; Yolanda Campos; Raffaella Auciello; Ana Cabello 📂 Article 📅 2000 🏛 John Wiley and Sons 🌐 English ⚖ 116 KB 👁 2 views

We identified a novel missense mutation in the myophosphorylase gene (PYGM) in a Spanish patient with McArdle's disease. This homozygous T-to-C transition results in the replacement of a highly conserved tryptophan at amino acid position (aa) 797 with an arginine in the C-terminal domain of the PYGM

Novel heterozygous missense mutation in

Novel heterozygous missense mutation in the platelet glycoprotein Ibβ gene associated with isolated giant platelet disorder

✍ Shinji Kunishima; Tomoki Naoe; Tadashi Kamiya; Hidehiko Saito 📂 Article 📅 2001 🏛 John Wiley and Sons 🌐 English ⚖ 408 KB

A novel missense mutation S65C in the HF

A novel missense mutation S65C in the HFE gene with a possible role in hereditary haemochromatosis

✍ Elizabeth Fagan; Stewart J. Payne 📂 Article 📅 1999 🏛 John Wiley and Sons 🌐 English ⚖ 10 KB 👁 2 views

## Detection conditions sequence of primers: F: ACATGGTTAAGGCCTGTTGC R: GCCACATCTGGCTTGAAATT PCR conditions: 3 min at 94oC; 30 cycles of 1 min 94oC, 1 min at 62oC and 1 min at 72oC; 10 min at 72oC electrophoresis: SSCP -10% native polyacrylamide gel (37.5:1 acrylamide: bis-acrylamide), 0.5x TBE,