✦ LIBER ✦

Two Dimensional and Three Dimensional Interactions between Bovine Serum Albumin and Chondroitin Sulfate

✍ Scribed by Xu, Shouhong; Yonese, Masakatsu

Book ID: 111776839
Publisher: Nature Publishing Group
Year: 2007
Tongue: English
Weight: 143 KB
Volume: 39
Category: Article
ISSN: 0032-3896
DOI: 10.1295/polymj.pj2006123

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Enhanced two-photon excited fluorescence

Enhanced two-photon excited fluorescence in three-dimensionally crosslinked bovine serum albumin microstructures

✍ Dong, Chen Yuan; Chen, Shean-Jen; Cho, Keng-Chi; Lien, Chi-Hsiang; Lin, Chun-Yu; 📂 Article 📅 2011 🏛 Optical Society of America 🌐 English ⚖ 845 KB

Interaction between Xanthoxylin and Bovi

Interaction between Xanthoxylin and Bovine Serum Albumin

✍ Maogui WEN; Jianniao TIAN; Yonglin HUANG; Hedong BIAN; Zhengfeng CHEN; Hong LIAN 📂 Article 📅 2009 🏛 John Wiley and Sons 🌐 English ⚖ 190 KB 👁 2 views

Interactions between O-carboxymethylchit

Interactions between O-carboxymethylchitosan and bovine serum albumin

✍ Hao Wu; Aiping Zhu; Lanhua Yuan 📂 Article 📅 2008 🏛 Elsevier Science 🌐 English ⚖ 765 KB

Interactions between PAMAM dendrimers an

Interactions between PAMAM dendrimers and bovine serum albumin

✍ Barbara Klajnert; Lidia Stanisławska; Maria Bryszewska; Bartłomiej Pałecz 📂 Article 📅 2003 🏛 Elsevier Science 🌐 English ⚖ 767 KB

Interactions between imazethapyr and bov

Interactions between imazethapyr and bovine serum albumin: Spectrofluorimetric study

✍ Maria E. Pacheco; Liliana Bruzzone 📂 Article 📅 2012 🏛 Elsevier Science 🌐 English ⚖ 306 KB

Analysis of Interaction between Dendripl

Analysis of Interaction between Dendriplexes and Bovine Serum Albumin

✍ Shcharbin, Dzmitry; Pedziwiatr, Elzbieta; Chonco, Louis; Bermejo-Martín, Jesus F 📂 Article 📅 2007 🏛 American Chemical Society 🌐 English ⚖ 117 KB

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTC-