Pyrosequencing™ technology at elevated temperature

✍ Scribed by Jonas Eriksson; Baback Gharizadeh; Tommy Nordström; Pål Nyrén

• Publisher: John Wiley and Sons
• Year: 2004
• Tongue: English
• Weight: 181 KB
• Volume: 25
• Category: Article
• ISSN: 0173-0835
• DOI: 10.1002/elps.200305708

✦ Synopsis

Abstract

To date, the Pyrosequencing™ technology has been performed at 28°C due to the low thermostability of the firefly luciferase. In this study, firefly luciferase was stabilized in the presence of glycine betaine, allowing DNA sequencing at 37°C. By increasing the temperature to 37°C, false signals due to primer‐dimers and loop‐structures were decreased significantly. In addition, a combination of (i) replacing the natural dGTP with 7'deaza‐dGTP in the polymerase chain reaction (PCR), (ii) 1.6 M glycine betaine, and (iii) an increase of the temperature to 37°C enabled us to sequence a DNA template with the initial sequence 3'‐ATGGCCCGGGGGGGAGCTCCA … 5'. Furthermore, we describe a method to analyze if a primer forms a primer‐dimer with extendable 3'‐ends.