Human glucokinase regulatory protein (GCKR): cDNA and genomic cloning, complete primary structure, and chromosomal localization

✍ Scribed by J. P. Warner; J. P. Leek; S. Intody; A. F. Markham; D. T. Bonthron

• Book ID: 104737866
• Publisher: Springer-Verlag
• Year: 1995
• Tongue: English
• Weight: 574 KB
• Volume: 6
• Category: Article
• ISSN: 0938-8990
• DOI: 10.1007/bf00356171

✦ Synopsis

Null mutations in the glucokinase (GCK) gene can cause autosomal dominant type 2 diabetes (maturity onset diabetes of the young, MODY); however, MODY is genetically heterogeneous. In both liver and pancreatic islet, glucokinase is subject to inhibition by a regulatory protein (GCKR). Given the role of GCK in MODY, GCKR is itself a candidate type 2 diabetes susceptibility gene. Here we describe the structure of full-length (2.2 kb) cDNA for human GCKR, from the hepatoblastoma cell line HepG2. The human GCKR translation product has 625 amino acids and a predicted molecular weight of 68,700. It has 88% amino acid identity to rat GCKR. Yeast artificial chromosomes (YAC clones) containing human GCKR were isolated, and the gene was mapped to Chromosome (Chr) 2p23 by fluorescent in situ hybridization and somatic cell hybrid analysis.

GGACTCTCTGCTCCCTTTGTGGCAGGCCAGATGGACTGCTGCATGAACAACACAGCTGTCTTCTTGCCAGTCCTGGTTGGCTTCAATCCA GlyLeuSerAla~r~PheValA~aGlyGlnMetAspCysCysMetAsnAsnThrAla~alPheLeu~r~valLeuValGlvPheA~npr~

GTGAGCATGGCCAGAAATGACCCCATTGAAGACTGGAGTTCAACATTCCGACAAGTAGCAGAGCGGATGCAGAAAATGCAGGAGAAACAG