𝔖 Bobbio Scriptorium
✦   LIBER   ✦

Evolution of the Rubisco operon from prokaryotes to algae: Structure and analysis of therbcSgene of the brown algaPylaiella littoralis

✍ Scribed by Nour-Eddine Assali; William F. Martin; Charles C. Sommerville; Susan Loiseaux-de Goër


Publisher
Springer
Year
1991
Tongue
English
Weight
769 KB
Volume
17
Category
Article
ISSN
0167-4412

No coin nor oath required. For personal study only.

✦ Synopsis


The rbcS gene coding for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) of the brown alga Pylaiella littoralis is located within the plastid genome and is transcribed as a single polycistronic mRNA with the gene for the large subunit of Rubisco, rbcL. The structure of the Rubisco operon from P. littoralis was determined. Molecular phylogenies for rbcS and rbcL with a wide range of prokaryotes and eukaryotes were constructed which are congruent with recent evidence for polyphyletic plastid origins. Both rbcL and rbcS of the beta-purple bacterium Alcaligenes eutrophus clearly cluster with the rhodophyte and chromophyte proteins. The data suggest that the Rubisco operons of red algal and chromophytic plastids derive from beta-purple eubacterial antecedents, rather than the cyanobacterial lineage of eubacteria from which other of their genes derive. This implies a lateral transfer of Rubisco genes from beta-purple eubacterial ancestors to the cyanobacterial ancestor of rhodophyte and chromophyte plastids.


📜 SIMILAR VOLUMES


Sequence, proposed secondary structure,
✍ C. C. Somerville; S. Jouannic; S. Loiseaux-de Goër 📂 Article 📅 1992 🏛 Springer 🌐 English ⚖ 781 KB

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG

Structural elucidation and conformationa
✍ Midori Ishitsuka; Takenori Kusumi; Hiroshi Kakisawa; Yoshiyuki Kawakami; Yasushi 📂 Article 📅 1986 🏛 Elsevier Science 🌐 French ⚖ 253 KB

From the brown alga, Pachydictyon coriaceum, three new 'germacrane-type' diterpenes, acetoxypachydiol (41, 3-hydroxyacetyldilophol (21, and dilophol acetate (z), have been isolat-

Concerted application of a shift reagent
✍ Gabriele M. König; Anthony D. Wright 📂 Article 📅 1995 🏛 John Wiley and Sons 🌐 English ⚖ 473 KB

## Abstract From the marine brown alga __Dictyopteris delicatula__ Lamaouroux, two new (1, 3) and two previously reported sesquiterpenes (2, 4) were isolated and characterized. Compound 1 was identified as 4β,5α‐dihydroxycubenol and 2 was found to be a non‐racemic mixture of (±)‐torreyol. Compound