The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAG
Evolution of the Rubisco operon from prokaryotes to algae: Structure and analysis of therbcSgene of the brown algaPylaiella littoralis
✍ Scribed by Nour-Eddine Assali; William F. Martin; Charles C. Sommerville; Susan Loiseaux-de Goër
- Publisher
- Springer
- Year
- 1991
- Tongue
- English
- Weight
- 769 KB
- Volume
- 17
- Category
- Article
- ISSN
- 0167-4412
No coin nor oath required. For personal study only.
✦ Synopsis
The rbcS gene coding for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) of the brown alga Pylaiella littoralis is located within the plastid genome and is transcribed as a single polycistronic mRNA with the gene for the large subunit of Rubisco, rbcL. The structure of the Rubisco operon from P. littoralis was determined. Molecular phylogenies for rbcS and rbcL with a wide range of prokaryotes and eukaryotes were constructed which are congruent with recent evidence for polyphyletic plastid origins. Both rbcL and rbcS of the beta-purple bacterium Alcaligenes eutrophus clearly cluster with the rhodophyte and chromophyte proteins. The data suggest that the Rubisco operons of red algal and chromophytic plastids derive from beta-purple eubacterial antecedents, rather than the cyanobacterial lineage of eubacteria from which other of their genes derive. This implies a lateral transfer of Rubisco genes from beta-purple eubacterial ancestors to the cyanobacterial ancestor of rhodophyte and chromophyte plastids.
📜 SIMILAR VOLUMES
From the brown alga, Pachydictyon coriaceum, three new 'germacrane-type' diterpenes, acetoxypachydiol (41, 3-hydroxyacetyldilophol (21, and dilophol acetate (z), have been isolat-
## Abstract From the marine brown alga __Dictyopteris delicatula__ Lamaouroux, two new (1, 3) and two previously reported sesquiterpenes (2, 4) were isolated and characterized. Compound 1 was identified as 4β,5α‐dihydroxycubenol and 2 was found to be a non‐racemic mixture of (±)‐torreyol. Compound