Determination of the specific interaction between palmatine and bovine serum albumin
β Scribed by Yu Ou-Yang; Xiao-Ling Li; Hong Wang; Min Fang; Yan-Jun Hu
- Book ID
- 113075839
- Publisher
- Springer
- Year
- 2011
- Tongue
- English
- Weight
- 469 KB
- Volume
- 39
- Category
- Article
- ISSN
- 0301-4851
No coin nor oath required. For personal study only.
π SIMILAR VOLUMES
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTC-
The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific bindin