𝔖 Bobbio Scriptorium
✦   LIBER   ✦

Determination of conformational transition rates in the trp promoter by1H NMR rotating-frame T1and cross-relaxation rate measurements

✍ Scribed by Andrew N. Lane; Christopher J. Bauer; Thomas A. Frenkiel


Publisher
Springer
Year
1993
Tongue
English
Weight
758 KB
Volume
21
Category
Article
ISSN
1432-1017

No coin nor oath required. For personal study only.

✦ Synopsis


Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lef~vre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s-1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAAT-TA).d(CACTAACTGTTAAT), which contains the -35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.