Combined neutron and X-ray diffraction studies of DNA in crystals and solutions
✍ Scribed by Leal, Ricardo M. F. ;Callow, Shirley ;Callow, Phil ;Blakeley, Matthew P. ;Cardin, Christine J. ;Denny, William A. ;Teixeira, Susana C. M. ;Mitchell, Edward P. ;Forsyth, V. Trevor
- Publisher
- International Union of Crystallography
- Year
- 2010
- Tongue
- English
- Weight
- 760 KB
- Volume
- 66
- Category
- Article
- ISSN
- 0907-4449
No coin nor oath required. For personal study only.
✦ Synopsis
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
📜 SIMILAR VOLUMES
The fibrous state is a natural one for polymer molecules which tend to assume regular helical conformations rather than the globular structures characteristic of many proteins. Fibre diffraction therefore has broad application to the study of a wide range of biological and synthetic polymers. The pu
## Abstract For Abstract see ChemInform Abstract in Full Text.
To standardize industrial implant production and make comparisons between different experimental results, we have to be able to quantify the crystallinity of hydroxyapatite. Methods of measuring crystallinity ratio were developed for various HA samples before and after plasma spraying. The first ser