Abstract
The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010. © 2010 Wiley‐Liss, Inc.