An optimized extended DNA kappa B site that enhances plasmid DNA nuclear import and gene expression

✍ Scribed by Cristine Gonçalves; Marie-Yvonne Ardourel; Martine Decoville; Gilles Breuzard; Patrick Midoux; Brigitte Hartmann; Chantal Pichon

• Publisher: John Wiley and Sons
• Year: 2009
• Tongue: English
• Weight: 279 KB
• Volume: 11
• Category: Article
• ISSN: 1099-498X
• DOI: 10.1002/jgm.1312

✦ Synopsis

Abstract

Background

The nuclear factor kappa B (NFκB) transcription factor, which shuttles between the cytoplasm and the nucleus under specific conditions, is a suitable intracellular target to increase the nuclear import of plasmid DNA. We report the design of an optimized and extended NFκB DNA binding sequence that promotes an efficient plasmid nuclear import.

Methods

On the basis of structural studies, the 5′‐CTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGG‐3′ segment (termed 3NF) comprising three 10‐bp κB sites (GGGACTTTCC) separated by a 5‐bp optimized spacer (AGCTG) was selected for its capacity to ensure the best structural fit with NFκB and to fix simultaneously three proteins. Plasmids encoding luciferase and bearing this sequence (3NF‐plasmids) were constructed and their nuclear import and gene expression efficiencies compared with that of plasmids containing classical κB motifs.

Results

A high luciferase expression was associated with plasmids containing one (p3NF‐luc) or two (p3NF‐luc‐3NF) 3NF sequences. In situ hybridization experiments and quantitative measurement of the number of plasmid copies demonstrated that the nuclear delivery of 3NF‐plasmids was more efficient than that of 3NF‐free plasmids. Cross‐linked immunoprecipitation showed that 3NF‐plasmids were recognized by NFκB inside cells upon transfection. The nuclear delivery was inhibited with BAY 11‐7085, an inhibitor of NFκB activation. Finally, p3NF‐luc‐3NF, the most efficient construct for in vitro transfection, had a long‐lived luciferase expression in vivo.

Conclusions

The results obtained in the present study demonstrate the NFκB‐mediated nuclear delivery of 3NF‐plasmids. Due to its high affinity for fixing several NFκB, the 3NF sequence is a very promising helper for a nonviral gene delivery system. Copyright © 2009 John Wiley & Sons, Ltd.