✦ LIBER ✦

An isotachophoretic analysis of the interaction of bilirubin and biliverdin with bovine serum albumin

✍ Scribed by Peter Oefner; Dr. Adam Csordas; Georg Bartsch; Hans Grunicke

Book ID: 102834003
Publisher: John Wiley and Sons
Year: 1985
Tongue: English
Weight: 719 KB
Volume: 6
Category: Article
ISSN: 0173-0835
DOI: 10.1002/elps.1150061105

No coin nor oath required. For personal study only.

📜 SIMILAR VOLUMES

Spectroscopic analysis of the interactio

Spectroscopic analysis of the interaction between bilirubin and bovine serum albumin

✍ Chen, Juan ;Song, Gongwu ;He, Yu ;Yan, Qiujun 📂 Article 📅 2007 🏛 Springer-Verlag ⚖ 170 KB

The Interaction of BODIPY with bovine se

The Interaction of BODIPY with bovine serum albumin and its bilirubin complex

✍ Solomonov, A. V.; Rumyantsev, E. V.; Kochergin, B. A.; Antina, E. V. 📂 Article 📅 2014 🏛 SP MAIK Nauka/Interperiodica 🌐 English ⚖ 767 KB

Conformation of bilirubin and biliverdin

Conformation of bilirubin and biliverdin in their complexes with serum albumin

✍ Blauer, G.; Wagniere, G. 📂 Article 📅 1975 🏛 American Chemical Society 🌐 English ⚖ 567 KB

Interaction of ergosterol with bovine se

Interaction of ergosterol with bovine serum albumin and human serum albumin by spectroscopic analysis

✍ Cheng, Zhengjun 📂 Article 📅 2012 🏛 Springer 🌐 English ⚖ 869 KB

Competitive interaction of biliverdin an

Competitive interaction of biliverdin and bilirubin only at the primary bilirubin binding site on human albumin

✍ Charles E. Ahlfors 📂 Article 📅 1981 🏛 Elsevier Science 🌐 English ⚖ 947 KB

Analysis of Interaction between Dendripl

Analysis of Interaction between Dendriplexes and Bovine Serum Albumin

✍ Shcharbin, Dzmitry; Pedziwiatr, Elzbieta; Chonco, Louis; Bermejo-Martín, Jesus F 📂 Article 📅 2007 🏛 American Chemical Society 🌐 English ⚖ 117 KB

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTC-